NGSgrade Oligos - The next Level                                            
progress bar
progress bar

eurofins eurofins

Email
Password
 
  
Forgot Password?
Create Account
 
 
  • Quick Order
  • 0

    Cart

  • Account
    • Login
    • Create Account
  • Products & Services
    • DNA / RNA Oligos
      • Products & Services
      • DNA / RNA Oligos
        • qPCR application oligos
        • PCR Primers
        • qPCR Probes
        • Ultimate Precision Probes
        • Next Generation Sequencing Oligos
        • NGSgrade Oligos
        • NGSgrade Oligos 2.0
        • NGS UDI Primer Sets
        • Sanger Sequencing Oligos
        • SeqPrimer
        • Standard Primers
        • Cloning applications & CRISPR
        • Cloning Oligo
        • EXTEmers
        • Custom DNA & RNA Oligos
        • Custom DNA Oligos
        • Salt Free Oligos
        • Custom RNA Oligos
        • siMAX siRNA
        • Large Scale Oligos
        • Special Requests
        • Oligo Design Tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • qPCR Assay Design Tool
        • Sequencing Primer Design Tool
        • Helpful Links
        • Oligo Decision Tree
        • Oligo Excel Upload Forms

        • Prepaid Oligo Coupons
          A Unique Prepayment Option for PCR - and Sequencing Primers
          Learn more

           

           

    • Gene Synthesis & Molecular Biology
      • Products & Services
      • Gene Synthesis & Molecular Biology
        • Synthetic genes
        • Standard Genes
        • Express Genes
        • Complex Genes
        • Gene synthesis project
        • Gene Fragments
        • GeneStrands
        • Express GeneStrands
        • Molecular Biology Services
        • Plasmid Preparation
        • Site Directed Mutagenesis
        • DNA Cloning
        • Optimisation tool
        • GENEius
    • Sanger Sequencing
      • Products & Services
      • Sanger Sequencing
        • Sequencing Services
        • Mix2Seq Services
        • LightRun Services
        • TubeSeq Supreme
        • PlateSeq Supreme
        • Direct Colony Sequencing
        • Prepaid Products
        • Mix2Seq Kits
        • LightRun Barcodes
        • Barcode Labels & Coupons
        • PlateSeq Kits
        • Shipping Options
        • Sequencing Accessories
        • Sample Shipment
        • Additional Services
        • Sequencing Primers
        • Free Barcode Labels
        • Special Sequencing Services
        • Sequence Verification and Primer Walking under ISO 17025 & GLP
        • �
          Mix2Seq Kit
          Fastest Sanger sequencing of premixed samples in tubes.

          Order Now

           

           

    • Nanopore Sequencing
      • Products & Services
      • Nanopore Sequencing
        • ONT Lite Portfolio
        • Whole Plasmid Sequencing
        • Linear / Clonal Amplicons
        • Bacterial Genome Sequencing
        • Hybrid Assembly
        • Yeast Genome Sequencing
        • Prepaid ONT Coupons
        • Free barcodes
        • Genome Sequencing
        • Human Whole Genome Sequencing
        • Bacteria Whole Genome Sequencing
        • Whole Genome Sequencing Non-Human
        • Amplicon Sequencing
        • Custom Long-Read Amplicon Sequencing
        • 16S Full-Length Microbiome
        • Prepaid ONT Lite Coupons
          A Unique Prepayment Option for your sequencing with Oxford Nanopore

          Learn more

           

           

    • Next Generation Sequencing
      • Products & Services
      • Next Generation Sequencing
        • Genome Sequencing
        • Human WGS
        • Non-human WGS
        • INVIEW Resequencing
        • Microbiome & Metagenome
        • INVIEW Microbiome
        • INVIEW Metagenome
        • Amplicon Sequencing
        • Amplicon sequencing
        • Amplicon sequencing - incl. amplification
        • Transcriptome
        • INVIEW Transcriptome
        • INVIEW Transcriptome Bacteria
        • NGSelect RNA
        • Exome & Enrichment
        • INVIEW Exome
        • Clinical Research Exome
        • INVIEW Oncoprofiling
        • INVIEW Liquid Biopsy Oncoprofiling
        • Bioinformatic Services
        • RNA-Seq Analysis
        • Variant Analysis Service
        • Metagenome Analysis Service
        • Microbiome Profiling Analysis
        • Prepaid Coupons and free Barcodes
        • Free Barcodes
        • NGS Prepaid Coupons
        • Important information
        • Sample Submission Guidelines
        • NGS Publications
        • Special applications
        • INVIEW CRISPR Check
        • INVIEW Virus
        • Ready-to-Load
        • Prepaid NGS Coupons

           

          A Unique Prepayment Option for our NGS Services

          Learn more

           

           

    • Genotyping & Genexpression
      • Products & Services
      • Genotyping & Genexpression
        • Applied Genomic Services
        • DNA Barcoding
        • Cell Line Authentication
        • Mycoplasmacheck
        • Fragment Length Analysis
        • Genotyping Services
        • SNP Genotyping
        • Copy Number Variation
        • Mikrosatellites/ STR/FLA/ IDAA
        • Gene Expression Services
        • Transcriptome analysis
        • Expression Arrays
        • Target Gene Expression
  • Markets
    • Pharma / Biotech
      • Markets
      • Pharma / Biotech
        • Synthesis Products
        • Industrial-grade NGS Oligos
        • Ultimate Precision Probes
        • Special Oligo Requests
        • Large Scale Oligos
        • Gene Synthesis
        • Gene Fragments
        • Sequencing Services
        • Exome Sequencing
        • Transcriptome Sequencing
        • Genome Sequencing
        • Bioinformatic Solutions for NGS
        • Favorite Content
        • NGS - Disease Diagnostics
        • Cancer Ecology
        • Personalised Cancer Therapy
        • Revolutionising human-like-protein production
        • The Microbiome Of Cancer
        • All about biomarker discovery
    • Agrigenomics
      • Markets
      • Agrigenomics
        • Plant Breeder
        • DNA marker discovery
        • Marker-assisted selection
        • GRAS-Di®
        • Microbiome and metagenomics
        • Animal Breeder
        • DNA Marker discovery
        • Pathogen screening
        • Parentage testing
        • Genomic selection
        • Marker-assisted selection
        • Webshop - GenFarmEval
        • Favorite Content
        • Microarrays Accelerate Blue Biotechnology
        • How To Do NGS 50% Faster
        • NGS Portfolio
        • GenFarmEval.com

          Visit our Webshop for Farmers

          learn more

    • Consumer Genomics
      • Markets
      • Consumer Genomics
        • Sequencing Services
        • Genotyping
        • Epigenome Profiling
        • Microbiome Analysis
        • Shotgun Sequencing
        • Whole Genome Sequencing
        • Additional Services
        • Sample Collection Kits
        • Shipping
        • DNA Extraction
        • Laboratory Service
        • Biobanking
        • Favorite Content
        • Population Genetics
        • The End of Gene Doping
        • Home Genomics Testing
        • IVDR Compliance
    • Food & Environment
      • Markets
      • Food & Environment
        • Food Testing
        • Food Authenticity
        • Meat Traceability
        • Pathogen Traceability
        • Cannabis and Hemp Testing
        • Environmental Testing
        • Non-targeted detection of organisms / species
        • Targeted detection of organisms / species
        • eDNA Tracker
        • Favorite Content
        • Determine the Source of Meat
        • Pine Nuts – Why Testing For Edibility Matters
    • Diagnostic Kit Producer
      • Markets
      • Diagnostic Kit Producer
        • Synthesis Products
        • Large Scale Oligos
        • Special Requests in Tubes
        • Quality Assurance
        • GLP
        • ISO 17025
        • ISO 13485
        • Favorite Content
        • Oligonucleotides For Diagnostics
        • The Future of RNA Applications
    • Research / Biotech
      • Markets
      • Research / Biotech
        • Favorite Services
        • Custom DNA Oligos
        • TubeSeq Service Sanger
        • INVIEW Microbiome NGS
        • NGS Services
        • GeneStrands
        • Express Services
        • Mix2Seq NightXpress
        • Express Genes
        • Express GeneStrands
        • Favorite Content
        • Eurofins Genomics Goes Green
        • GENEius – Codon Usage Optimisation
        • 5 tips to speed up your qPCR
        • Why salt-free oligos are the unsung hero of molecular biology
  • Resources
    • Account
      • Resources
      • Account
        • My profile
        • Orders
        • Quotes
        • Groups
        • Preferences
        • Addresses
        • Dropboxes Nearby
        • Barcode Management
        • Sanger Barcode Management
        • NGS Barcode Management
        • Genotyping Barcode Management
        • Oligo Barcode Management
        • Primer / Cell Line Management
        • Sanger Sequencing Primers
        • Cell Line Management
    • Solutions
      • Resources
      • Solutions
        • EVOCARD Options
        • EVOcard Payment Method
        • Order or Refill EVOcards
        •  

    • Other Resources
      • Resources
      • Other Resources
        • Frequently Asked Questions (FAQs)
        • Video Tutorials
        • GENEius
        • Excel Upload Forms Oligos
    • Tools
      • Resources
      • Tools
        • Design tools
        • PCR Primer Design Tool
        • Sequencing Primer Design Tool
        • Oligo Analysis Tool
        • qPCR Assay Design
  • About us
    • About Us
      • About us
      • About Us
        • About Eurofins
        • Careers
        • Distributors
        • News
        • Holiday Hours
    • Quality Control
      • About us
      • Quality Control
        • Quality Assurance
    • Promotions
      • About us
      • Promotions
        • View all promotions
  • Contact
Logo
  • Products & Services
    • DNA / RNA Oligos
      • Products & Services
      • DNA / RNA Oligos
        • qPCR application oligos
        • PCR Primers
        • qPCR Probes
        • Ultimate Precision Probes
        • Next Generation Sequencing Oligos
        • NGSgrade Oligos
        • NGSgrade Oligos 2.0
        • NGS UDI Primer Sets
        • Sanger Sequencing Oligos
        • SeqPrimer
        • Standard Primers
        • Cloning applications & CRISPR
        • Cloning Oligo
        • EXTEmers
        • Custom DNA & RNA Oligos
        • Custom DNA Oligos
        • Salt Free Oligos
        • Custom RNA Oligos
        • siMAX siRNA
        • Large Scale Oligos
        • Special Requests
        • Oligo Design Tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • qPCR Assay Design Tool
        • Sequencing Primer Design Tool
        • Helpful Links
        • Oligo Decision Tree
        • Oligo Excel Upload Forms

        • Prepaid Oligo Coupons
          A Unique Prepayment Option for PCR - and Sequencing Primers
          Learn more

           

           

    • Gene Synthesis & Molecular Biology
      • Products & Services
      • Gene Synthesis & Molecular Biology
        • Synthetic genes
        • Standard Genes
        • Express Genes
        • Complex Genes
        • Gene synthesis project
        • Gene Fragments
        • GeneStrands
        • Express GeneStrands
        • Molecular Biology Services
        • Plasmid Preparation
        • Site Directed Mutagenesis
        • DNA Cloning
        • Optimisation tool
        • GENEius
    • Sanger Sequencing
      • Products & Services
      • Sanger Sequencing
        • Sequencing Services
        • Mix2Seq Services
        • LightRun Services
        • TubeSeq Supreme
        • PlateSeq Supreme
        • Direct Colony Sequencing
        • Prepaid Products
        • Mix2Seq Kits
        • LightRun Barcodes
        • Barcode Labels & Coupons
        • PlateSeq Kits
        • Shipping Options
        • Sequencing Accessories
        • Sample Shipment
        • Additional Services
        • Sequencing Primers
        • Free Barcode Labels
        • Special Sequencing Services
        • Sequence Verification and Primer Walking under ISO 17025 & GLP
        • �
          Mix2Seq Kit
          Fastest Sanger sequencing of premixed samples in tubes.

          Order Now

           

           

    • Nanopore Sequencing
      • Products & Services
      • Nanopore Sequencing
        • ONT Lite Portfolio
        • Whole Plasmid Sequencing
        • Linear / Clonal Amplicons
        • Bacterial Genome Sequencing
        • Hybrid Assembly
        • Yeast Genome Sequencing
        • Prepaid ONT Coupons
        • Free barcodes
        • Genome Sequencing
        • Human Whole Genome Sequencing
        • Bacteria Whole Genome Sequencing
        • Whole Genome Sequencing Non-Human
        • Amplicon Sequencing
        • Custom Long-Read Amplicon Sequencing
        • 16S Full-Length Microbiome
        • Prepaid ONT Lite Coupons
          A Unique Prepayment Option for your sequencing with Oxford Nanopore

          Learn more

           

           

    • Next Generation Sequencing
      • Products & Services
      • Next Generation Sequencing
        • Genome Sequencing
        • Human WGS
        • Non-human WGS
        • INVIEW Resequencing
        • Microbiome & Metagenome
        • INVIEW Microbiome
        • INVIEW Metagenome
        • Amplicon Sequencing
        • Amplicon sequencing
        • Amplicon sequencing - incl. amplification
        • Transcriptome
        • INVIEW Transcriptome
        • INVIEW Transcriptome Bacteria
        • NGSelect RNA
        • Exome & Enrichment
        • INVIEW Exome
        • Clinical Research Exome
        • INVIEW Oncoprofiling
        • INVIEW Liquid Biopsy Oncoprofiling
        • Bioinformatic Services
        • RNA-Seq Analysis
        • Variant Analysis Service
        • Metagenome Analysis Service
        • Microbiome Profiling Analysis
        • Prepaid Coupons and free Barcodes
        • Free Barcodes
        • NGS Prepaid Coupons
        • Important information
        • Sample Submission Guidelines
        • NGS Publications
        • Special applications
        • INVIEW CRISPR Check
        • INVIEW Virus
        • Ready-to-Load
        • Prepaid NGS Coupons

           

          A Unique Prepayment Option for our NGS Services

          Learn more

           

           

    • Genotyping & Genexpression
      • Products & Services
      • Genotyping & Genexpression
        • Applied Genomic Services
        • DNA Barcoding
        • Cell Line Authentication
        • Mycoplasmacheck
        • Fragment Length Analysis
        • Genotyping Services
        • SNP Genotyping
        • Copy Number Variation
        • Mikrosatellites/ STR/FLA/ IDAA
        • Gene Expression Services
        • Transcriptome analysis
        • Expression Arrays
        • Target Gene Expression
  • Markets
    • Pharma / Biotech
      • Markets
      • Pharma / Biotech
        • Synthesis Products
        • Industrial-grade NGS Oligos
        • Ultimate Precision Probes
        • Special Oligo Requests
        • Large Scale Oligos
        • Gene Synthesis
        • Gene Fragments
        • Sequencing Services
        • Exome Sequencing
        • Transcriptome Sequencing
        • Genome Sequencing
        • Bioinformatic Solutions for NGS
        • Favorite Content
        • NGS - Disease Diagnostics
        • Cancer Ecology
        • Personalised Cancer Therapy
        • Revolutionising human-like-protein production
        • The Microbiome Of Cancer
        • All about biomarker discovery
    • Agrigenomics
      • Markets
      • Agrigenomics
        • Plant Breeder
        • DNA marker discovery
        • Marker-assisted selection
        • GRAS-Di®
        • Microbiome and metagenomics
        • Animal Breeder
        • DNA Marker discovery
        • Pathogen screening
        • Parentage testing
        • Genomic selection
        • Marker-assisted selection
        • Webshop - GenFarmEval
        • Favorite Content
        • Microarrays Accelerate Blue Biotechnology
        • How To Do NGS 50% Faster
        • NGS Portfolio
        • GenFarmEval.com

          Visit our Webshop for Farmers

          learn more

    • Consumer Genomics
      • Markets
      • Consumer Genomics
        • Sequencing Services
        • Genotyping
        • Epigenome Profiling
        • Microbiome Analysis
        • Shotgun Sequencing
        • Whole Genome Sequencing
        • Additional Services
        • Sample Collection Kits
        • Shipping
        • DNA Extraction
        • Laboratory Service
        • Biobanking
        • Favorite Content
        • Population Genetics
        • The End of Gene Doping
        • Home Genomics Testing
        • IVDR Compliance
    • Food & Environment
      • Markets
      • Food & Environment
        • Food Testing
        • Food Authenticity
        • Meat Traceability
        • Pathogen Traceability
        • Cannabis and Hemp Testing
        • Environmental Testing
        • Non-targeted detection of organisms / species
        • Targeted detection of organisms / species
        • eDNA Tracker
        • Favorite Content
        • Determine the Source of Meat
        • Pine Nuts – Why Testing For Edibility Matters
    • Diagnostic Kit Producer
      • Markets
      • Diagnostic Kit Producer
        • Synthesis Products
        • Large Scale Oligos
        • Special Requests in Tubes
        • Quality Assurance
        • GLP
        • ISO 17025
        • ISO 13485
        • Favorite Content
        • Oligonucleotides For Diagnostics
        • The Future of RNA Applications
    • Research / Biotech
      • Markets
      • Research / Biotech
        • Favorite Services
        • Custom DNA Oligos
        • TubeSeq Service Sanger
        • INVIEW Microbiome NGS
        • NGS Services
        • GeneStrands
        • Express Services
        • Mix2Seq NightXpress
        • Express Genes
        • Express GeneStrands
        • Favorite Content
        • Eurofins Genomics Goes Green
        • GENEius – Codon Usage Optimisation
        • 5 tips to speed up your qPCR
        • Why salt-free oligos are the unsung hero of molecular biology
  • Resources
    • Account
      • Resources
      • Account
        • My profile
        • Orders
        • Quotes
        • Groups
        • Preferences
        • Addresses
        • Dropboxes Nearby
        • Barcode Management
        • Sanger Barcode Management
        • NGS Barcode Management
        • Genotyping Barcode Management
        • Oligo Barcode Management
        • Primer / Cell Line Management
        • Sanger Sequencing Primers
        • Cell Line Management
    • Solutions
      • Resources
      • Solutions
        • EVOCARD Options
        • EVOcard Payment Method
        • Order or Refill EVOcards
        •  

    • Other Resources
      • Resources
      • Other Resources
        • Frequently Asked Questions (FAQs)
        • Video Tutorials
        • GENEius
        • Excel Upload Forms Oligos
    • Tools
      • Resources
      • Tools
        • Design tools
        • PCR Primer Design Tool
        • Sequencing Primer Design Tool
        • Oligo Analysis Tool
        • qPCR Assay Design
  • About us
    • About Us
      • About us
      • About Us
        • About Eurofins
        • Careers
        • Distributors
        • News
        • Holiday Hours
    • Quality Control
      • About us
      • Quality Control
        • Quality Assurance
    • Promotions
      • About us
      • Promotions
        • View all promotions
  • Contact
Login | Create Account

NGSgrade Oligos - The next Level

  • You are here:
  • DNA & RNA|Oligonucleotides >
  • Optimised Application Oligos >
  • NGSgrade Oligos

 

 

NGSgrade Oligos 2.0 - The next level of high-quality NGS oligonucleotides


Extensively tested and found superior.

 

 

Our high-quality NGS oligonucleotides help to achieve:

 

  • High analytical performance parameter
  • Superiour NGS data quality
  • Correct data interpretation and research conclusions
  • Right decision on follow up experiments and research studies

 

 

Order NGSgrade 2.0 in Tubes

Order NGSGRADE Oligos in Tubes

Request a Quote for Plates

 

Modern next generation sequencing platforms allow many samples to be analysed in parallel. To utilise the capacities, the samples are pooled, which increases the risk of incorrectly assigned data. The samples are labelled using index primers so that the data can be correctly assigned later. In order to minimise so-called cross-talk as far as possible, the oligonucleotides used must contain as few or no other indexing primers as possible. Cross-contamination of index primers must therefore be avoided as far as possible during production.


Eurofins Genomics offers a synthesis process that significantly reduces the cross-contamination rate of oligonucleotides compared to other oligonucleotides for NGS applications on the market (see application note). With typical values of 0.01 – 0.05%, the cross-contamination rate of NGSgrade 2.0 oligonucleotides is at a market-leading level, making them the perfect choice for any library preparation using indexed adapters for multiplex sequencing.

 

NGSgrade Oligos 2.0


Proprietary synthesis and purification technology for lowest cross-contamination rates:

  • Typical cross-contamination rate of 0.01 - 0.05%.
  • Recommended for all types of indexing primers, such as UDIs or UDI-UMIs, where cross-contamination can lead to incorrect data interpretation if NGS reads are misassigned.
  • For other applications where oligo cross contamination is critical

NGSgrade Oligos with HPLC purification


HPLC-purified NGS oligos, including specific post-synthesis processes to reduce cross-contamination:

  • Traces of cross-contamination with co-synthesized oligos cannot be fully excluded.
  • These oligos should be used for NGS applications where low levels of cross-contamination have less impact and highest purity is an essential factor instead.
 

>> FAQ's Oligonucleotides

>> FAQ's Next Gen Sequencing

NGS Oligos for MiSeq

NGS Oligos for NOvaSeq

 

 

Related Information

 

 

Specifications NGSgrade Oligos 2.0

What you can expect from our NGSgrade Oligos 2.0

 

  • Typical cross contamination rate of 0.01% - 0.05% determined by our NGS lab (see cross-contamination rate)
  • Available minimum quantities of 4 nmol, 10 nmol and 25 nmol
  • DNA sequence length from 15 - 120 bases
  • Available modifications are PTO bounds, 2’-Desoxyinosine, 2’-Desoxyuridine and 5’-Phosphate
  • Quality is ensured by OD measurement and ESI-MS (electrospray ionization mass spectrometry)
  • An online quality report, including the ESI-MS spectra, can be ordered
  • Selectable solvents are bidest water, TE buffer (10 mM Tris, 1 mM EDTA; pH=8) or Low EDTA Puffer (10 mM Tris, 0.1 mM EDTA pH = 8)
  • Fast delivery times from 8 working days

 

 

For delivery in tubes:

  • Oligos are supplied in 2ml screw cap tubes either lyophilized or in liquid form at the selected concentration

 

For delivery in plates:

  • Oligos are supplied in the selected 96well plate in liquid form at the defined concentration
  • A minimum of 20 oligos per 96-well plate is required

 

 

 

 

Cross-Contamination Rate NGSgrade 2.0

 

The cross-contamination rate of 0.01 – 0.05% was determined by sequencing representative sets of Unique Dual Index (UDI) primer pairs using Illumina instruments at Eurofins Genomics’ European NGS sequencing facility. The rate given represents the typical total percentage of read pairs not matching the expected UDI combinations for a set of 96 UDI primer pairs. The corresponding Application Note shows a cross-contamination rate of 0.0014% for a set of 14 UDI primer pairs.

Please note that the total cross-contamination rate (percentage of incorrectly assigned read pairs) is influenced by the total amount of UDI primer pairs analysed in parallel. The more UDI primers are analysed, the higher the total cross-contamination can get, as more unexpected index combinations can be attributed.

In all cases, the actual cross-contamination of primers would be even lower as stated above. This is because the association of reads with other unexpected UDI primer pairs is a result of primer cross-contamination and index hopping during sequencing. Discriminating between these causes is not possible in this analysis setup.


Please note that Eurofins Genomics does not determine the cross-contamination rate for each individual set of NGS oligonucleotides produced and shipped.

 

 

  Total cross-contamination rate
per UDI set 
(% total read pairs not matching the expected UDI combinations
Lowest measured cross-contamination per UDI combination Reference
Eurofins Genomics NGSgrade Oligos 2.0 Typically 0.01 - 0.05% 0.00446% Set of 96 UDI primer pairs
Eurofins Genomics NGSgrade Oligos 2.0 0.0014%
(see application note)
0.00045% Set of 14 UDI primer pairs
Other supplier 0.0208%
(see application note)
0.00767% Set of 14 UDI primer pairs

 

Purity and Coupling Rate NGSgrade 2.0

Product Data

Eurofins Genomics uses a new and proprietary synthesis device to produce high performance NGSgrade 2.0 oligonucleotides. This equipment enables best-in-class coupling efficiencies, resulting in a high percentage of non-truncated, full-length oligonucleotides.

Figure 1. Theoretical purities for NGSgrade 2.0 oligonucleotides. (A) Plot of theoretical purities for different lengths of oligos applying a coupling rate of 99.6%. This average coupling rate was determined based on a large and representative sample of data points. (B) Example IP-RP-HPLC-chromatogram for a UDI adapter primer of 72 nucleotides, recorded at λ = 260 nm. A purity of 74.0% was measured for the target product. Analytical IP-RP UHPLC was performed on a Vanquish Horizon Duo system from ThermoFisher Scientific.

 

 

 

Oligos for Amplicons on NovaSeq (150 - 270 bp)

Adapter Ligation Oligos for NGS amplicon sequencing on NovaSeq

 

High quality adapter oligos to improve multiplexing with sample tagging by NGS on Illumina. They are designed and validated by our in-house NextGen sequencing lab:

  • 192 individual designed tags are available to label your samples
  • Each tag consist of 10 nucleotides which will be added to your template specific forward primer*.
  • The tags are designed with a minimum edit distance of 4, which prevents in a best possible way mis-assignments in case of sequencing errors
  • Tags are optimised for sample pools with low and high amount of samples
  • All NGSgrade Oligos undergo a specific cross-contamination free processes to guarantee best purity and performance

 

Please use our Excel template provided on the NGSgrade 2.0 Oligo order page, which is specifically coded for designing your amplicon adaptor ligation oligos.


The designed primers can be used for our NGSelect Amplicon Adaptor Ligation product or with your own sequencing protocol.

 

*For e.g. multiplexing of 24 samples with the same target specific sequence, the same forward primer sequence must be used 24 times and one reverse primer. On each forward primer the design tool will add a different tag. The reverse primer will not get tags.

 

Oligos for Amplicons on MiSeq (280 - 570 bp)

2nd PCR Oligos for NGS amplicon sequencing on MiSeq


Amplicon 2nd PCR Oligos are specifically designed to enable sample pooling for NGS on Illumina platforms. They are developed and validated by our in-house NextGen sequencing lab.

 

When performing NGS amplicon sequencing on MiSeq, primers with universal adaptors are required for the first PCR.


For your convenience, Eurofins Genomics automatically adds these adaptors to your target-specific sequences. This automated process during online ordering ensures that your primers have the correct, validated, and optimized design. To facilitate this, please use our Excel template, available on the NGSgrade 2.0 Oligo order page.

 

Adaptor sequences:

  • Forward Primer Sequence: ACACTCTTTCCCTACACGACGCTCTTCCGATCT
  • Reverse Primer Sequence: GACTGGAGTTCAGACGTGTGCTCTTCCGATCT

 

The designed primers are compatible with our NGSelect Amplicon MiSeq service.

 

 

 

Specifications NGSgrade Oligos

What you can expect from our NGSgrade Oligos

 

Optimised and verified product specifications:

  • Guaranteed purity of > 80% by HPLC purification
  • Specific cross-contamination free processes after synthesis
  • Stringent quality criteria checked by MALDI-TOF MS
  • Synthesis scales from 0.01 to 1.0 µmol
  • Selectable delivery format: lyophilised and concentration adjusted
  • Delivery time: 
    • 5-7 working days for up to 60 mers
    • 10 working days for > 61 mers

 


Minimum yields (OD) per scale:

Synthesis scale
0.01 µmol
0.05 µmol
0.2 µmol
1.0 µmol
HPLC
Minimum Yield [OD] 1 2 4 10

 The synthesis scale indicates the initial amout of 3'-bases. 

 


Additional online features free of charge

  • Add a personal note to your oligo resp. plate
  • Calculate the complementary sequence
  • Select your preferred label layout for your oligo tubes
  • Track production and delivery status online
  • View your order history under "My Orders

 

 

 

Literature

 

Oligonucleotide brochure

Application Note NGSgrade Oligos 2.0 

 

 

 

 

Solutions you may also like

 

 

 

PlateSeq Service


Sanger sequencing of all sample types in 96well plates


>> READ MORE

 

 

 

INVIEW Metagenome


Deep insights into the microbiota of your sample


>> READ MORE

 

 

 

NGS Coupons


The perfect prepaid solution for your NGS projects


>> READ MORE

 

 

 

EVOCard


The prepaid card for more
flexibility in your research


>> READ MORE

 

 

Quality is important for us at Eurofins

Our products and services are produced and performed under strict quality management and quality assurance systems.

Find certificates here
Contact Us

TECHNICAL SUPPORT

Phone: +49 7531 816068

E-Mail: support-eu@genomics.eurofinseu.com

HOURS

Mon-Thu: 8 : 00 AM – 6 : 00 PM, ET

Fri: 8 : 00 AM – 6 : 00 PM, ET

TOLL FREE PHONE NUMBER

Direct Line: 00800-200 100 20

E-Mail: support-eu@genomics.eurofinseu.com

HOURS

Mon-Fri: 8 : 00 AM – 3 : 00 PM, ET

QUOTES, PRICING & SPECIAL REQUESTS

Quotes are submitted, reviewed, and accepted through the online quoting tool. Learn more.
Please direct inquires about pricing and special project requests to your sales representative.
General questions: support-eu@genomics.eurofinseu.com

Change Region

  • Europe (current website)
  • Americas
  • India
  • Japan

We love hearing from our customers. Feel free to leave feedback.

Submit Feedback
Careers
  • ISO 9001
  • ISO 13485
  • ISO 17025

2025 - Copyright Eurofins Genomics

  • Terms & Conditions
  • Corporate
  • Privacy
Frequently asked questions
Contact us
Subscribe to newsletter
VEGA Beta