w10.0.27 | c9.0.90.05
PROD | u7.5.14
 

 

WHO and CDC primer & probe sequences

Primer and probe sequences recommended by the CDC & WHO

These materials are provided for research purposes only.


CDC Approved Sequences

Name Description Sequence (5' -> 3') Label

Working Conc.

2019-nCoV_N1-F

2019-nCoV_N1
Forward Primer

GAC CCC AAA ATC AGC GAA AT - 20 µM
2019-nCoV_N1-R

2019-nCoV_N1 
Reverse Primer

TCT GGT TAC TGC CAG TTG AAT CTG - 20 µM
2019-nCoV_N1-P

2019-nCoV_N1
Probe

FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1 FAM,
BHQ-1
5 µM
2019-nCoV_N2-F

2019-nCoV_N2
Forward Primer

TTA CAA ACA TTG GCC GCA AA - 20 µM
2019-nCoV_N2-R

2019-nCoV_N2
Reverse Primer

GCG CGA CAT TCC GAA GAA - 20 µM
2019-nCoV_N2-P

2019-nCoV_N2
Probe

FAM-ACA ATT TGC CCC CAG CGC TTC AG-BHQ1 FAM,
BHQ-1
5 µM
2019-nCoV_N3-F

2019-nCoV_N3
Forward Primer

GGG AGC CTT GAA TAC ACC AAA A - 20 µM
2019-nCoV_N3-R

2019-nCoV_N3
Reverse Primer

TGT AGC ACG ATT GCA GCA TTG - 20 µM
2019-nCoV_N3-P

2019-nCoV_N3 Probe

FAM-AYC ACA TTG GCA CCC GCA ATC CTG-BHQ1 FAM,
BHQ-1
5 µM
RP-F

RNAse P 
Forward Primer

AGA TTT GGA CCT GCG AGC G - 20 µM
RP-R

RNAse P 
Reverse Primer

GAG CGG CTG TCT CCA CAA GT - 20 µM
RP-P

RNAse 
Probe

FAM – TTC TGA CCT GAA GGC TCT GCG CG – BHQ-1 FAM,
BHQ-1
5 µM

 

WHO Approved Sequences

Assay

Name Sequence (5' -> 3')

Comment

 
RdRP
gene
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction  
 
RdRP_SARSr-R1

CARATGTTAAASACACTATTAGCATA
use 800 nM per reaction
  RdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV,
will not detect SARS-CoVuse
100 nM per reaction
and mix with P1
  RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe,
will detect 2019-nCoV, SARS-CoV
and bat-SARS-related CoVsuse
100 nM per reaction and mix with P2
       
E gene E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT Use 400 nM per reaction
  E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA Use 400 nM per reaction
  E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nM per reaction



Publications

  1. (2020) 2019 Novel Coronavirus (2019-nCoV), Wuhan, China. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  2. (2020) 2019-Novel coronavirus (2019-nCoV) real-time rRT-PCR panel primers and probes. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  3. (2020) Real-time RT-PCR panel for detection 2019-novel coronavirus. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  4. (2020) Emergency use authorization. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].

 

 

Scroll to top ^^