w10.0.27 | c9.0.90.04
PROD | u7.5.14
Header Image
 

 

print content
increase font
decrease font

rRT-PCR Primers & Probes zur Detektion des 2019-nCoV

Von der CDC empfohlene Primer und Sonden

Eurofins Genomics kann Forschern, die am Coronavirus arbeiten, die von der CDC und der WHO empfohlenen Primer- und Probessequenzen zur Verfügung stellen.

Die Sequenzen wurden von der CDC (hier klicken) und von der WHO (hier klicken) öffentlich zur Verfügung gestellt. Forscher können diese Primer und Sonden bestellen, um in ihrem Labor ein Panel zu erstellen, indem sie den Panel-Anweisungen des CDC folgen.

Dieses Material wird nur zu Forschungszwecken bereitgestellt.

 
CDC genehmigte Sequenzen*

Name Beschreibung Sequenz (5' -> 3') Label

Konzentration

2019-nCoV_N1-F

2019-nCoV_N1
Forward Primer

GAC CCC AAA ATC AGC GAA AT - 20 µM
2019-nCoV_N1-R

2019-nCoV_N1 
Reverse Primer

TCT GGT TAC TGC CAG TTG AAT CTG - 20 µM
2019-nCoV_N1-P

2019-nCoV_N1
Probe

FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1 FAM,
BHQ-1
5 µM
2019-nCoV_N2-F

2019-nCoV_N2
Forward Primer

TTA CAA ACA TTG GCC GCA AA - 20 µM
2019-nCoV_N2-R

2019-nCoV_N2
Reverse Primer

GCG CGA CAT TCC GAA GAA - 20 µM
2019-nCoV_N2-P

2019-nCoV_N2
Probe

FAM-ACA ATT TGC CCC CAG CGC TTC AG-BHQ1 FAM,
BHQ-1
5 µM
2019-nCoV_N3-F

2019-nCoV_N3
Forward Primer

GGG AGC CTT GAA TAC ACC AAA A - 20 µM
2019-nCoV_N3-R

2019-nCoV_N3
Reverse Primer

TGT AGC ACG ATT GCA GCA TTG - 20 µM
2019-nCoV_N3-P

2019-nCoV_N3 Probe

FAM-AYC ACA TTG GCA CCC GCA ATC CTG-BHQ1 FAM,
BHQ-1
5 µM
RP-F

RNAse P 
Forward Primer

AGA TTT GGA CCT GCG AGC G - 20 µM
RP-R

RNAse P 
Reverse Primer

GAG CGG CTG TCT CCA CAA GT - 20 µM
RP-P

RNAse 
Probe

FAM – TTC TGA CCT GAA GGC TCT GCG CG – BHQ-1 FAM,
BHQ-1
5 µM

 

>> Jetzt bestellen



WHO genehmigte Sequenzen

Assay

Name Sequenz (5' -> 3')

Anleitung

 
RdRP
gene
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG 600 nM / Reaktion  
 
RdRP_SARSr-R1

CARATGTTAAASACACTATTAGCATA
800 nM / Reaktion
  RdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Speziell für 2019-nCoV werden SARS-CoVuse 100 nM pro Reaktion nicht nachgewiesen und mit P1 gemischt
  RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe erkennt 2019-nCoV, SARS-CoV und Fledermaus-SARS-bezogene CoVs, verwendet 100 nM pro Reaktion und mischt sich mit P2
       
E gene E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT 400 nM / Reaktion
  E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA 400 nM / Reaktion
  E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ 200 nM / Reaktion

 

Bestellmöglichkeit

Wir empfehlen unsere qPCR Assay Bestellseite für optimierte und validierte Primers und Probes.

Für die WHO RdRP gene Primer und Sonden, verwenden Sie bitte unsere Dual Labelled Probe und qPCR Primer Bestellseite. 



Publikationen

  1. (2020) 2019 Novel Coronavirus (2019-nCoV), Wuhan, China. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  2. (2020) 2019-Novel coronavirus (2019-nCoV) real-time rRT-PCR panel primers and probes. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  3. (2020) Real-time RT-PCR panel for detection 2019-novel coronavirus. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  4. (2020) Emergency use authorization. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].


Anmerkung

Um eine Kreuzkontamination von Primern und Probes mit Kontrollplasmiden zu verhindern, nutzen wir unser Standardverfahren und trennen unsere Produktion von Oligos und Genen / Plasmisden räumlich. Dazu zählt auch ein seperates Luftsystem!

*Eurofins Genomics betont, dass diese Materialien in keiner Weise von der CDC validiert wurden.

Scroll to top ^^