w10.0.27 | c9.0.90.07
PROD | u7.5.14
Header Image


print content
increase font
decrease font

rRT-PCR Primers & Probes zur Detektion des 2019-nCoV

Von der CDC empfohlene Primer und Sonden

Eurofins Genomics kann Forschern, die am Coronavirus arbeiten, die von der CDC und der WHO empfohlenen Primer- und Probessequenzen zur Verfügung stellen.

Die Sequenzen wurden von der CDC (hier klicken) und von der WHO (hier klicken) öffentlich zur Verfügung gestellt. Forscher können diese Primer und Sonden bestellen, um in ihrem Labor ein Panel zu erstellen, indem sie den Panel-Anweisungen des CDC folgen.

Dieses Material wird nur zu Forschungszwecken bereitgestellt.

CDC genehmigte Sequenzen*

Name Beschreibung Sequenz (5' -> 3') Label



Forward Primer


Reverse Primer



5 µM

Forward Primer


Reverse Primer



5 µM

Forward Primer


Reverse Primer


2019-nCoV_N3 Probe

5 µM

RNAse P 
Forward Primer


RNAse P 
Reverse Primer



5 µM


>> Jetzt bestellen

WHO genehmigte Sequenzen


Name Sequenz (5' -> 3')



800 nM / Reaktion
  RdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Speziell für 2019-nCoV werden SARS-CoVuse 100 nM pro Reaktion nicht nachgewiesen und mit P1 gemischt
  RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe erkennt 2019-nCoV, SARS-CoV und Fledermaus-SARS-bezogene CoVs, verwendet 100 nM pro Reaktion und mischt sich mit P2
E gene E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT 400 nM / Reaktion
  E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA 400 nM / Reaktion



Wir empfehlen unsere qPCR Assay Bestellseite für optimierte und validierte Primers und Probes.

Für die WHO RdRP gene Primer und Sonden, verwenden Sie bitte unsere Dual Labelled Probe und qPCR Primer Bestellseite. 


  1. (2020) 2019 Novel Coronavirus (2019-nCoV), Wuhan, China. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  2. (2020) 2019-Novel coronavirus (2019-nCoV) real-time rRT-PCR panel primers and probes. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  3. (2020) Real-time RT-PCR panel for detection 2019-novel coronavirus. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  4. (2020) Emergency use authorization. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].


Um eine Kreuzkontamination von Primern und Probes mit Kontrollplasmiden zu verhindern, nutzen wir unser Standardverfahren und trennen unsere Produktion von Oligos und Genen / Plasmisden räumlich. Dazu zählt auch ein seperates Luftsystem!

*Eurofins Genomics betont, dass diese Materialien in keiner Weise von der CDC validiert wurden.

Scroll to top ^^