w6.0.16 | c6.0.57.14
PROD | u6.1.6
Header Image service-corner
 

 

Frequently Asked Questions About Our Products And Services



How can I order my oligos?

We generally recommend to order online via our Ecom system. This is the most convenient and secure way and you benefit from several online features like order tracking, order history and archived documents.

If you are not able to order online, please use our order forms from our website and send it via email to orderbox-eu@eurofins.com.

Can I order by uploading an excel file?

Yes you can.

You just need to assign one column with the oligo names and another one for the sequences. Please use "oligo name" and "sequence" as headlines as described in the file examples.

The name of the oligo is restricted to 16 characters. Save your excel file as .xls on your personal computer. No further format rules have to be considered. Upload your file in the format entry "from file" and press save.

How can I order degenerated/wobble bases?

A mixture of bases is commonly known as a wobble base. Please find the universal nomenclature (IUPC code) in the following table. Just include the respective character in the oligo sequence.

M R W S Y K V H D B N
AC AG AT GC CT GT AGC ACT AGT GCT AGCT

A wobble is generated by equal amounts of different phosphoramidites in one coupling reaction during synthesis. Not all nucleosides are equally incorporated during synthesis; it is not uncommon to observe a slight bias at the wobble position in the final product.

In addition to standard wobbles (i.e. Y (CT) 50:50) you can also order wobbles in a defined ratio (i.e. CT 30:70) by choosing "wobble defined ratio" in the drop down menu within the "internal modifications (X)" section in your oligo order form. Please define your requested ratio in the comment field (e.g.: X=Y= 30:70).

How can I order oligos with phosphorothioate bonds (PTO)?

You can find a specific order form for phosphorothioate (PTO) oligonucleotides "PTO oligos" in the Customised DNA Oligo menu of our Ecommerce System. To define the sequence, please use capital letters for phosphodiester (DNA) bases and lower case letters for phosphorothioate (PTO) bases.

e.g.: "TTTaGCTCaCTCgTTcAA" or full PTO "atcgatcgatcgactagctgttcgatc".
To modify the first two bases at the 5'- and 3´end please write "5' - agCTCTGCGCAACGTCGacg -3' ".

For email or fax orders you can adopt the same format.

Can I order modified RNA?

Yes. Please use the order form for "modified RNA oligos" in the "RNA oligos" menu within your Ecom account. 3' and 5' modifications may be selected.

How do I order chimeric oligos?

Please select "chimeric oligos" in the "RNA oligos" order menu of our Ecommerce System.

To define the sequence

  • use capital letters for phosphodiester (DNA) bases
  • lower case letters for phosphorothioate (PTO) bases
  • 2'O-Methyl RNA components of the oligo should be placed within square brackets [ ]
  • RNA components of the oligo should be put within parentheses ( )

e.g. ATC(AUG)gtg[ACG] will define an oligo where positions 1-3 are standard DNA bases, positions 4-6 are RNA bases, positions 7-9 are PTO-DNA bases and positions 10-12 are 2'O-Methyl RNA bases.

How can I cancel or amend an order?

It is possible to change or cancel your oligonucleotide order within 30 minutes after your order has been sent.
If you have ordered via our Ecommerce System, you can cancel your order by yourself using the link "cancel order" in the "my orders" menu.
Alternatively, you can call our customer support team (+49 8092 8289-77) within our official business hours.

How can I track my order?

If you ordered through our Ecommerce System you can track the status of your order directly within your online account. To do this, please choose the function "my orders" -> "track oligos". As soon as the order is ready for dispatch you will see the status "in delivery" and you are now able to track your DHL shipment with the button "tracking of this delivery".

If you have ordered via fax or email, and recorded your email address in the order form, you will receive an order confirmation by email. Within this email you will find a link for tracking the status of your order. As soon as the order is ready for dispatch, you will see the status "in delivery" and you can track your shipment using the link "DHL".

Please be aware that even if a tracking number has been assigned during working hours, the parcels will not be collected until the evening. Tracking of the shipment before collection from our production facility will not be possible.

Scroll to top ^^