w6.0.12 | c6.0.57.10
PROD | u6.1.6
Header Image service-corner


print content
increase font
decrease font

Frequently Asked Questions About Our Products And Services

DNA & RNA oligonucleotides

Products & services

Which oligo product fits to my application?

As a matter of course the quality of our oligonucleotides should consistently fulfil the performance criteria of your application and arrive in your lab right on time.

For the most common applications like PCR, qPCR, DNA cloning and DNA sequencing by Sanger we offer pre-defined and optimised primer and probes validated in respective applications.

See which primer is right for you!

For all applications which are not covered by our Optimised Application Oligos we offer customised DNA & RNA oligos where you can specify your oligo according to your individual requirements.

What does HPSF mean?

HPSF is the abbreviation for Eurofins Genomics proprietary High Purity Salt Free purification method. It is a cartridge purfication technology based on liquid chromatography.

Eight elution steps with different eluents, including acidic on-line cleavage of the dimethoxytrityl (DMT) protecting group guarantees that almost all n-x products, all protecting groups and salts are washed off the raw product.

Multiple HPSF robots in each production facility allow a high throughput purification of thousands of oligos per day.

Which quality controls do you perform?

OD measurement

The final yield of an oligo is determined by measuring the OD (Optical Density) values. One OD260 unit of DNA is the amount of DNA that gives an absorbance reading of 1.0 at a wavelength of 260 nm, for a sample dissolved in 1.0 ml total volume of ddH20 which is read in a 1 cm quartz cuvette. 1 OD260 corresponds to approx. 33 µg/ml of single stranded DNA, depending on the GC content.


To ensure the identity and qualitative purity of each and every synthesised oligonucleotide, we use the latest generation of Sequenom MALDI-TOF (Matrix Assisted Laser Desorption Ionisation - Time of Flight) mass spectrometers. The high grade of automation and the use of proprietary software to analyse the spectra ensures that we deliver oligonucleotides of highest quality.

Capillary Gel Electrophoresis (CGE)

CGE is an effective method for checking the quantitative purity of the synthesised oligonucleotides. It is performed routinely on unmodified oligonucleotides >60 bases which have been purified by RP-HPLC or HYPUR. The electropherograms can be provided along with the synthesis report as quality documentation.

How to order

How can I order my oligos?

We generally recommend to order online via our Ecom system. This is the most convenient and secure way and you benefit from several online features like order tracking, order history and archived documents.

If you are not able to order online, please use our order forms from our website and send it via email to orderbox-eu@eurofins.com.

Can I order by uploading an excel file?

Yes you can.

You just need to assign one column with the oligo names and another one for the sequences. Please use "oligo name" and "sequence" as headlines as described in the file examples.

The name of the oligo is restricted to 16 characters. Save your excel file as .xls on your personal computer. No further format rules have to be considered. Upload your file in the format entry "from file" and press save.

How can I order degenerated/wobble bases?

A mixture of bases is commonly known as a wobble base. Please find the universal nomenclature (IUPC code) in the following table. Just include the respective character in the oligo sequence.


A wobble is generated by equal amounts of different phosphoramidites in one coupling reaction during synthesis. Not all nucleosides are equally incorporated during synthesis; it is not uncommon to observe a slight bias at the wobble position in the final product.

In addition to standard wobbles (i.e. Y (CT) 50:50) you can also order wobbles in a defined ratio (i.e. CT 30:70) by choosing "wobble defined ratio" in the drop down menu within the "internal modifications (X)" section in your oligo order form. Please define your requested ratio in the comment field (e.g.: X=Y= 30:70).

How can I order oligos with phosphorothioate bonds (PTO)?

You can find a specific order form for phosphorothioate (PTO) oligonucleotides "PTO oligos" in the Customised DNA Oligo menu of our Ecommerce System. To define the sequence, please use capital letters for phosphodiester (DNA) bases and lower case letters for phosphorothioate (PTO) bases.

e.g.: "TTTaGCTCaCTCgTTcAA" or full PTO "atcgatcgatcgactagctgttcgatc".
To modify the first two bases at the 5'- and 3´end please write "5' - agCTCTGCGCAACGTCGacg -3' ".

For email or fax orders you can adopt the same format.

Can I order modified RNA?

Yes. Please use the order form for "modified RNA oligos" in the "RNA oligos" menu within your Ecom account. 3' and 5' modifications may be selected.

How do I order chimeric oligos?

Please select "chimeric oligos" in the "RNA oligos" order menu of our Ecommerce System.

To define the sequence

  • use capital letters for phosphodiester (DNA) bases
  • lower case letters for phosphorothioate (PTO) bases
  • 2'O-Methyl RNA components of the oligo should be placed within square brackets [ ]
  • RNA components of the oligo should be put within parentheses ( )

e.g. ATC(AUG)gtg[ACG] will define an oligo where positions 1-3 are standard DNA bases, positions 4-6 are RNA bases, positions 7-9 are PTO-DNA bases and positions 10-12 are 2'O-Methyl RNA bases.

How can I cancel or amend an order?

It is possible to change or cancel your oligonucleotide order within 30 minutes after your order has been sent.
If you have ordered via our Ecommerce System, you can cancel your order by yourself using the link "cancel order" in the "my orders" menu.
Alternatively, you can call our customer support team (+49 8092 8289-77) within our official business hours.

How can I track my order?

If you ordered through our Ecommerce System you can track the status of your order directly within your online account. To do this, please choose the function "my orders" -> "track oligos". As soon as the order is ready for dispatch you will see the status "in delivery" and you are now able to track your DHL shipment with the button "tracking of this delivery".

If you have ordered via fax or email, and recorded your email address in the order form, you will receive an order confirmation by email. Within this email you will find a link for tracking the status of your order. As soon as the order is ready for dispatch, you will see the status "in delivery" and you can track your shipment using the link "DHL".

Please be aware that even if a tracking number has been assigned during working hours, the parcels will not be collected until the evening. Tracking of the shipment before collection from our production facility will not be possible.

General technical questions

How do you synthesise your oligos?

We are using different synthesis machines with phosphoramidite chemistry (Caruthers, M.H. (1983) Tetrahedron Lett. 24:245-248).

The oligonucleotides are synthesised in 3' to 5' direction while attached covalently to a solid support (solid phase synthesis).The building blocks used for synthesis are DNA phosphoramidite nucleosides which are modified with different protection groups.

synthesis cycle

Synthesis starts with de-blocking (A) i.e. the cleavage of the 5' protection group dimethoxytrityl (DMT).

An activated phosphoramidite nucleoside couples with the free 5' hydroxyl function (B). Typically coupling efficiency is between 98% and 99.5%. Since the coupling efficiency is not 100%, a small percentage of truncated sequences is produced at every coupling step. If these failure sequences are allowed to further react, unwanted mutants would result.

This problem is overcome largely by capping the remaining free 5' hydroxyls through acetylation (C). Some molecules fail to cap and continue to participate in additional synthesis cycles, resulting in nearly full length molecules that contain internal deletions - the so-called (n-x) mer species.

After coupling, the DNA bases are connected by an unstable phosphite triester. It is converted to a stable phosphotriester linkage by oxidation (D). The oxidation step completes one cycle of oligo synthesis. DNA synthesis can continue with the removal of the DMT group at the 5' -end of the growing chain, starting another cycle of nucleotide addition.

Oligonucleotide cleavage from support and deprotection is achieved under alkaline conditions.

Does the sequence have an impact on synthesis success?

Eurofins Genomics has many years of experience in oligonucleotide synthesis. Occasionally we can identify oligonucleotides that are difficult to produce, due to their sequences. For example, oligonucleotides with a high percentage of "G" residues, especially stretches of "Gs", can be difficult to synthesise.
Moreover, oligos with four or more "Gs" in a row tend to aggregate and form a "guanine tetraplex" (Poon and MacGregor (1998) Biopolymers 45:427-434). Oligos with self-complementary sequences tend to form aggregates, and this formation can complicate HPSF, HPLC and HYPUR purification.

What is synthesis scale and synthesis yield?

The synthesis scale indicates the amount of starting material (CPG) of the solid phase synthesis process.

Not to be confused with the synthesis yield, which is depending on the coupling efficiency during synthesis.

The coupling efficiency again depends on raw material quality. The individual sequence and length of an oligonucleotide also influences the coupling efficiency and therefore the synthesis yield as shown in the table below:

CE 99.5%
CE 99.0%
C E 98.5%
  20mer 91 83 75
  30mer 86 75 65
  40mer 82 68 55
  60mer 74 55 41
100mer 61 37 22

Theoretical yield of full length product = coupling efficiency (CE) (length of oligonucleotide-1)

What does OD mean?

One OD260 (optical density) unit of DNA is the amount of DNA that gives an absorbance reading of 1.0 at a wavelength of 260 nm for a sample dissolved in 1.0 ml total volume of ddH2O, read in a 1 cm quartz cuvette. The OD value is used to determine the concentration of an unknown oligo solution by measuring the absorption at 260 nm.
1 OD260 corresponds to approx. 33 µg/ml of single stranded DNA.

Why is the oligo yield not reproducible every time?

Many factors can influence the yield. It depends on sequence composition and oligo length.

The main reason why you might see different yields for the same oligo (same sequence, same length), might be due to the column loading with CPG (controlled pore glass) material, used to initiate the synthesis. The minimum loading corresponds to the synthesis scale but fluctuation of the CPG amount and CPG loading can occur, which can lead to varying yields.

How long are unmodified oligonucleotides stable and how should I store them?

Our stability study shows that unmodified oligos are stable > 6 years by storing them lyophilised at -20 °C or below:

oligo stability table

The stability study has been performed using the analytical methods HPLC and MALDI-TOF MS as well as application based in DNA sequencing.

Once you have dissolved your oligonucleotides in sterile water or buffered solutions (or you have already received your oligonucleotide in the requested solution), the best way to store them is to prepare aliquots of several tubes, to lyophilise the aliquots, and to store them at -20 °C.

The sample which is currently in use can be kept in a refrigerator at +4° C for a short time to avoid continuous freezing and thawing of the solution.

What is the shelf life of oligonucleotides?

The shelf life of an oligonucleotide is determined by three factors.

1. Sensitivity to pH
In contrast to double strand DNA, single strand oligonucleotides have a significantly higher sensitivity to acidic pH values. Therefore, it is recommended that the media used for resuspension of the oligonucleotides lies in the basic pH range.

2. Nuclease degradation
There is a danger of degradation of the oligonucleotides through nuclease activity. This nuclease degradation is hastened by the presence of salts, in particular by two-valent and three-valent ions. Avoiding the introduction of such nucleases by taking suitable hygiene measures at the workplace, and the addition of low amounts of ethylenediamine tetra-acetic acid (EDTA) can be helpful.

3. Freeze/thaw sensitivity
Single stranded oligos can be affected by freezing and thawing cycles. Keeping these cycles to a minimum will ensure oligo integrity. Dispensing the master stock of oligo upon receipt into usable aliquots is good practice to reduce repeated handling.

How can I optimise the shelf life of oligos?

Recommended resuspension buffer

For the stock solution we recommend 10 mM Tris-EDTA pH 8.0.
To make the working solution, we recommend to dilute the stock solution with Tris-buffer. This lowers the EDTA concentration that may disturb in enzymatical reactions.

The buffer concentration should be adjusted to the corresponding amount of oligonucleotides as DNA has a relatively high acid strength of its own. This buffer is equivalent to the buffer systems that are currently used for molecular biological applications such as PCR or sequencing.

We do not recommend dissolving our Salt Free and HPSF oligonucleotides unbuffered in distilled water. Due to the salt free properties of these oligos, no buffer effect is possible.
In addition, we recommend regularly checking the distilled water quality which is used for the production of the buffer.

Avoiding multiple thawing and freezing processes

After resuspension with the Tris-EDTA solution, aliquots of the oligonucleotides should be prepared and stored at -20°C. Individual aliquots can then be kept in liquid form at +4°C if they will be consumed within 1-2 days.
If long-term storage is required (> ½ year), it is recommended to store the samples at -80°C free of water (lyophilised) to exclude any enzymatic activities. Long-term storage at -20°C is not adequate because the exclusion of any enzymatic reaction can't be guaranteed.
From our experience, oligonucleotides can be stored between one month and two years depending on their individual properties and their different intended purposes and handling.
Because of the variations in oligo properties, applications, and handling, we can not give a definite shelf life guarantee.

How to choose the right dye?

One of the most common uncertainties when starting a new assay is how to select the best fluorescent label from all of the available options.

An optimal selection is based on reviewing the spectral properties of each dye, in relation to the instrument to be used. Each instrument has features to consider such as excitation source, optical filters, and sensitivity.

The most important dye characteristics to review when choosing an appropriate dye, are absorption- and emission spectra, the fluorescence Stokes shift, the extinction coefficient, pH-sensitivity, stability to photobleaching as well as the quantum yield.

Which criteria are to be considered for choosing the right dye?

Absorption- and emission spectra of fluorescent dyes

The absorbance of a dye quantifies how much of visible or UV light is absorbed by it. The emission value shows at which wavelength a fluorescent dye sends light respective radiation out. Each fluorescent dye has its own absorption- and emission value (see schedule below). The choice of the right absorption-/ emission spectra of a dye depends on the individual assay as well on the type of instrument that is used.

Stokes shift

The difference in energy between the excitation and emission maximum is known as the Stokes shift. With fluorescent dyes, a large Stokes shift is often desirable when optical filters are used to separate exciting light and fluorescence emission.

Extinction coefficient

This value is a direct measurement of the dye's ability to absorb light. The ability to absorb light will clearly have an effect on the amount of light it is able to emit.

pH sensitivity

Some fluorophores are more sensitive to alkaline or acid pH conditions. For example, in alkaline solution above pH 9 some dye molecules could degrade. Other fluorophores are stable in alkaline as well as in acid pH ranges. One of the reasons for this is the structural characteristic of the molecules.

Stability to photobleaching

Photobleaching is the photochemical destruction of a fluorophore, which may impact the observation of fluorescent molecules, since they will eventually be destroyed by a constant light exposure. The loss of dye intensity respective of the quantum yield during experiments can produce erroneous results. However, it is important to consider your application and the instrument as well. For instance, stability to photobleaching is not as important for DNA sequencers and flow cytrometry as it is for fluorescence microscopy.

Fluorescence quantum yield

The quantum yield of a radiation induced process is the number of times that a defined event occurs per photon absorbed by the system. The fluorescence quantum yield (also quantum efficiency) gives the efficiency of the fluorescence process. It is defined as the ratio of the number of photons emitted to the number of photons absorbed. Generally, the maximum fluorescence quantum yield is 1.0 (100%).

The quantum yield of fluorescent labels strongly depends on the current existing microenvironment such as pH-value, type of solution, concentration or temperature. Therefore specific quantum yields of single fluorescent dyes can not be revealed.

Can I have different modifications in one oligonucleotide?

We offer more than 100 different modifications and provide oligos with multiple modifications or combinations of various modifications. Please be aware that the yield of oligos with multiple modifications is usually lower than those with fewer modifications.
The more you increase the number of modifications, combinations of modifications and the sequence length, the more complex the synthesis and purification of your oligonucleotide becomes. If you want to order multiple modified oligonucleotides, please contact our customer support team for advice.

Can I have different backbone modifications in one oligonucleotide?

Yes, all kinds of combinations of DNA and phosphorothioate (PTO) bases are possible.

How should fluorescent oligonucleotides be stored?

For the stock solution we recommend a 10 mM Tris-HCl, pH 8; 1mM EDTA dilution buffer for most modified oligos.

Oligos labelled with Cyano dyes (Cy3, CY3.5, Cy5 and Cy5.5) are only stable at pH 7.0. A higher pH would damage the dye molecule.

To make the working solution, we recommend to dilute the stock solution with Tris-buffer. This lowers the EDTA concetration that may disturb in enzymatical reactions.

In addition, we recommend regularly checking the distilled water quality which is used for the production of the buffer.

The best way to store the oligos is to aliquot them into several tubes, and store the aliquots at -20°C. The sample in current use can be kept in a refrigerator at +4°C for a short time to avoid continuous freezing and thawing of the solution.

Additionally, we strongly recommend protecting dye labelled oligonucleotides from light.

How should I resuspend my oligonucleotides in tubes and in plates?

For the stock solution we recommend 10 mM Tris-EDTA pH 8.0.

We do not recommend dissolving our Salt Free and HPSF oligonucleotides unbuffered in distilled water. Due to the salt free properties of these oligos, no buffer effect is possible.

In addition, we recommend regularly checking the distilled water quality which is used for the production of the buffer.

To make the working solution, we recommend diluting the stock solution with Tris-buffer. This lowers the EDTA concentration that may disturb in enzymatic reactions.

The buffer concentration should be adjusted to the corresponding amount of oligonucleotides as DNA has a relatively high acid strength of its own.

The standard concentration for stock solutions is 100 µM. To obtain a concentration of 100 µM the synthesis report provides you with the appropriate diluents' volume.

For your convenience please use our online dilution calculator MOPS in our Ecom System.

How do I anneal complementary oligos?

  1. Dissolve the lyophilised oligonucleotide in water or TE. Use the concentrations of your oligonucleotide solutions stated on the oligonucleotide synthesis report.
  2. Add the following components together:

    Stock                                             Final Concentration
    Oligonucleotide 1                             100 nmole/ml
    Oligonucleotide 2                             100 nmole/ml
    10x annealing buffer*                      1x
    Nuclease-free water                          to appropriate volume

    *10x annealing buffer: 100 mM Tris-HCI, pH 7.5,1 M NaCI and 10 mM EDTA.
  3. Heat the oligo solution to a temperature 10°C higher than the calculated melting temperature. Maintain the temperature for 10 minutes. Remove the solution from the heating block/water bath and allow it to cool slowly to room temperature on the bench (approximately 1 hour).

  4. Store the annealed oligos at -20°C as recommended.

How should Thiol-modified oligos be treated?

We recommend to reduce the thiol before using the oligo in your application:

1. Add 200 µl 10mM TCEP (solve 2,9mg TCEP-HCL in 1ml 1xTE buffer, pH 8.0) to your oligo

2. Shake it for 60 min at room temperature

3. Precipitate the oligo:

  • Add 150 µl 3 M Na-Acetate [24,6 g Na-Acetate + 0,21 g Mg-Acetate in 100 ml dest. H2O]
  • Fill tube with ethanol p.a.
  • Shake gently
  • Incubate 20 min at –20°C

4. Spin for 5 min at 13000 rpm, discard supernatant

5. Dry pellet at room temperature

TINA specific questions

Do I need a special primer design?

No special primer design is needed and there is no need to re-design existing primers or change the buffer system or DNA polymerase when using TINA.

Can TINA interfere with my general primer properties?

No. TINA enhances the thermal stability of an oligonucleotide duplex while leaving the ability to discriminate matching and mismatching oligonucleotides intact.

Does TINA work with all PCR assays?

TINA modified primers are built to perform in stressed end-point and real-time PCR assays. Assays which are already running at their optimum and the primer is not the limiting factor do not require TINA. In addition to primers, various other parameters such as large amplicon sized or high nucleic acid input can also limit your overall PCR. In such cases, a general review of the PCR protocol is required to get the PCR to perform. 

How low does TINA truly decrease the optimal primer concentration?

TINA modified primers reduce the necessary primer concentration by 30-50%.
A decrease in the optimal primer concentration reduces the likelihood of primer cross-reactivity or amplification of non-target nucleotide sequences.

How high does TINA truly increase the annealing temperature?

TINA increases the optimal annealing temperature by 3 to 8 °C. An increased annealing temperature reduces the probability of a PCR primer to anneal unspecifically thus increasing the overall PCR specificity.
An increased PCR sensitivity is also achieved due to the subsequently "relaxed" stringency of the primer annealing.

Can TINA improve the assay multiplexing capacity?

TINA modified primers reduce the primer concentration and increase the optimum annealing temperature. Both effects reduce the complexity of a multiplex assay and improve assay specifications.

How should I treat TINA labelled primers?

After you receive the TINA modified primers, please dissolve them in distilled water or Tris-buffer and leave them overnight in a refrigerator to completely dissovle. Since TINA modified primers are very hydrophobic, they require more time to dissolve after lyophilisation compared to standard DNA primers. Once the TINA modified primers are completely dissolved, they can be used just like any other DNA primer.


How do I calculate the extinction coefficient of an oligonucleotide?

For your convenience, please use our online calculation tool MOPS or apply the formula below:

The extinction coefficient at 260 nm (e260) is a unique physical property of each oligonucleotide. It is defined as the absorbance at 260 nm of a 1 M aqueous solution measured at 20 °C in an optical cell with 1 cm pathway (Lambert-Beer's law).
Purinic bases show a higher absorption (OD260) than pyrimidinic bases. Interactions between neighbouring bases, as well as modifications that absorb at 260nm, also influence optical absorbance. As a consequence, the extinction coefficient strongly depends on oligonucleotide sequence and composition.
The extinction coefficient of an oligonucleotide can be approximately (error up to 20 %) calculated using the following formula:

ε260 (mM-1 x cm-1) = (15.4 x nA) + (7.5 x nC) + (11.7 x nG) + (9.2 x nT)

where 15.4, 7.5, 11.7 and 9.2 are the monomer extinction coefficients in mM-1 cm-1 measured at
260 nm for dA, dC, dG and dT.

How do I calculate the molar amount N of an oligo from the OD value?

For your convenience, please use our online calculation tool MOPS or apply the formula below:

N [nmol] = OD x 100 / 1.54 x nA + 0.75 x nC + 1.17 x nG + 0.92 x nT

n = number of nucleosides of the type X


nA=7; nC=8; nG=5; nT=7
OD=12 (measured)

N [nmol] = 12 x 100 / 1.54 x 7 + 0.75 x 8 + 1.17 x 5 + 0.92 x 7
= 41.3

How do I calculate the mass amount m from the molar amount N of an oligo?

For your convenience, please use our online calculation tool MOPS or apply the formula below:

M[µg] = N x MW / 1000
MW = Molecular weight


nA=7; nC=8; nG=5; nT=7
MW (calculated) = 8219 g/mol
N= 41.3 nmol

M[µg] = 41.3 x 8219 / 1000 = 339

How do I calculate the molecular weight M of an oligonucleotide?

For your convenience, please use our online calculation tool MOPS or apply the formula below:

MW [g/mol]= 249.23 x nA + 240.21 x nT + 265.23 x nG + 225.20 x nC + 63.98 x (s-1) + 2.02

n = number of nucleosides of the type X
s = number of all nucleosides per sequence


nA=7; nC=8; nG=5; nT=7

MW [g/mol]= 249.23 x 7 + 240.21 x 7 + 265.23 x 5 + 225.20 x 8+ 63.98 x (s-1) + 2.02 = 8219.33

How do I calculate the melting temperature TM of an oligo?

The melting temperature TM, characterises the stability of the DNA hybrid formed between an oligonucleotide and its complementary strand.

For your convenience, please use our online calculation tool MOPS or apply the formula below:

Sequences with 15 or less bases 
TM [°C] = 2(nA + nT) + 4(nG + nC)

Sequences with more than 15 bases
TM [°C] = 69.3 + [41(nG + nC) / s - (650 / s)]

n = number of nucleosides of type X 
s = number of all nucleosides per sequence 


nA=7; nC=8; nG=5; nT=7 s= 27

Sequences with 15 or less bases
TM [°C] = 2(7 + 7) + 4(5 + 8) = 80.0

Sequences with more than 15 bases
TM [°C] = 69.3 + [41(5 + 8) / 27] - (650 / 27) = 69.3 + 19.7 - 24.0 = 65.0

How do I calculate the annealing temperature TA?

PCR                  TA [°C] = [(TM1 + TM2) / 2] - 3

Sequencing        TA [°C] = TM + 3

DNA Origami

Are there software tools for the design of DNA Origami objects?

Cadnano is a free DNA Origami design tool. You can download the software at http://cadnano.org.

CanDo is a structure prediction software for DNA Origami objects. Design files can be analysed at http://cando.dna-origami.org

Are the scaffold sequences identical to the sequences supplied with the cadnano software?

The sequence of the single-stranded scaffold DNA, type p7249 is identical to the sequence M13mp18 in cadnano.

The sequence of the single-stranded scaffold DNA, type p7560 is identical to the sequence p7560 in cadnano.

The sequence of the single-stranded scaffold DNA, type p8064 is identical to the sequence p8064 in cadnano.

How is the single-stranded scaffold DNA supplied?

The single-stranded scaffold DNA is supplied in liquid form in buffer containing 10 mM TRIS-BASE and 1 mM EDTA.

How should single-stranded scaffold DNA be stored?

We recommend storage at 4°C for short term ( up to 1 week ) storage. We recommend storage at -20°C for long term storage. Avoid multiple freeze-thaw cycles.

Let equilibrate after thawing. Avoid shearing, pipet gently.

Is the single-stranded scaffold DNA available at higher concentrations?

Solutions with single-stranded scaffold DNA concentrations above 400 nM become very viscous and difficult to handle. Please contact us if your application requires higher concentrations.

Scroll to top ^^